|
Entry Clone Source: 4BW5 |
|
Entry Clone Accession: IMAGE: 30915621 |
|
SGC Construct ID: KCNK10C-c011 |
|
GI number: 54207 |
|
Vector: pFB-CT10HF-LIC |
Amplified construct sequence:
ATGGGCTTGCAGACCGTCATGAAGTG |
|
Expressed sequence (small letters refer to tag sequence):
MGLQTVMKWKTVVAIFVVVVVYLVTG |
|
Tags and additions: C-terminal, TEV cleavable decahistidine / FLAG tag. |
|
Host: Spodoptera frugiperda (SF9) insect cells |
|
Growth medium, induction protocol: Insect cells with a density of 2x106 per litre of cell culture in SF900 medium (Invitrogen) were infected with recombinant baculovirus (5ml P2 virus per litre cell culture) and incubated for 65 hours. Cells were harvested by centrifugation and the pellet was flash frozen in liquid N2. |
|
Extraction method: Frozen pellets were thawed and re-suspended in extraction buffer supplemented with 1% OGNG/ 0.1% CHS and incubated at 4°C on a tube rotator. The extracted protein was separated from insoluble membranes by centrifugation and collected for purification. |
|
Extraction buffer: 50 mM HEPES, pH 7.5; 200 mM KCl; |
|
Column 1: Co-affinity. Cobalt Talon (Clontech), 1 ml of 50 % slurry/ 1L of cells in 1.5 x 10 cm column, washed with extraction/ wash buffer. |
|
Buffers: Wash buffer: 50 mM HEPES, pH 7.5; 200 mM KCl; 20 mM imidazole; detergent at 3x CMC. Elution buffer: 50 mM HEPES, pH 7.5; 200 mM KCl; 250 mM imidazole; detergent at 3xCMC |
|
Procedure: The solubilised membrane protein was batch bound to Cobalt Talon resin equilibrated with extraction buffer at 4°C for one hour and subsequently poured into a gravity flow glass column. The column was then washed with 30CV of wash buffer followed by elution in 1CV fractions until all the protein was eluted. |
|
Desalting: IMAC purified protein was loaded onto PD10 columns (GE healthcare) pre- equilibrated in extraction buffer supplemented with detergent at 3x CMC, and eluted with the same buffer. |
|
Enzymatic treatment: TEV protease (1:10, TEV:protein) and PNGaseF (1:20, PNGaseF:protein) was added overnight at 4°C to desalted protein. The enzymes were removed and tag cleaved protein was collected by binding to Cobalt talon and collecting the flow-through. |
|
Column 2:Size Exclusion Chromatography. Superose 6 (GE healthcare). |
|
SEC Buffer: 20 mM HEPES pH 7.5, 200 mM KCl, detergent at 2xCMC |
|
Procedure: The protein was concentrated and applied to a Superose 6 gel filtration column equilibrated with gel filtration buffer using an AKTA purifier system. |
|
Protein concentration: Protein was concentrated to ~20mg/ml using a 30kDa cut-off concentrator and back diluted to 9-11mg/ml. |
|
Crystallization: A 50 mM stock of norfluoxetine (Sigma-Aldrich) was dissolved in SEC buffer without detergent. This was added to the protein to give a final compound concentration of 5 mM and protein concentration of 9-11 mg/ml. Protein was incubated with compound for 3 h at 4°C prior to crystallization. The norfluoxetine co-crystals grew from a reservoir solution containing 0.2 M ammonium formate, 0.1 M Tris, pH 7.0 and 30 % (w/v) pentaerythritol ethoxylate (15/4) at 4°C. |
|
Cryocooling: Crystals were cryo-cooled directly from reservoir solution with added detergent (0.2 % OGNG / 0.02 % CHS).. |
|
Data Collection: Data were collected at 100K on beamline I02 at Diamond Light Source |
|
Structure Solution: The coordinates of the 'M4 down' conformational state of KCNK10C (4XDJ) were used as a search model in PHASER to provide initial phase estimates for this structure. Despite the different crystallization conditions, the 4XDK crystal form is very similar to that observed for the M4 down state crystals. Structure refined with BUSTER. As the ligand solution used for cocrystallisation is a chiral mixture, both (R)- and (S)-norfluoxetine enantiomers were modelled in the electron density with equal occupancy. The resolution of the electron density maps was not sufficient to conclude whether either one of the enantiomers was binding preferentially. All data to 3.6Å was used in refinement although, due to anisotropy, nominal resolution quoted below is based on Mn I/sI>2 criteria. |
|
Resolution: 3.7Å |