FKBP14A (4DIP) Materials & Methods

Entry Clone Source: MGC

Entry Clone Accession: gi|4042173

SGC Construct ID: FKBP14A-c007

Vector: pNIC-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
ATGAGGCTTTTCTTGTGGAACGCGGT
CTTGACTCTGTTCGTCACTTCTTTGA
TTGGGGCTTTGATCCCTGAACCAGAA
GTGAAAATTGAAGTTCTCCAGAAGCC
ATTCATCTGCCATCGCAAGACCAAAG
GAGGGGATTTGATGTTGGTCCACTAT
GAAGGCTACTTAGAAAAGGACGGCTC
CTTATTTCACTCCACTCACAAACATA
ACAATGGTCAGCCCATTTGGTTTACC
CTGGGCATCCTGGAGGCTCTCAAAGG
TTGGGACCAGGGCTTGAAAGGAATGT
GTGTAGGAGAGAAGAGAAAGCTCATC
ATTCCTCCTGCTCTGGGCTATGGAAA
AGAAGGAAAAGGTAAAATTCCCCCAG
AAAGTACACTGATATTTAATATTGAT
CTCCTGGAGATTCGAAATGGACCAAG
ATCCCATGAATCATTCCAAGAAATGG
ATCTTAATGATGACTGGAAACTCTCT
AAAGATGAGGTTAAAGCATATTTAAA
GAAGGAGTTTGAAAAACATGGTGCGG
TGGTGAATGAAAGTCATCATGATGCT
TTGGTGGAGGATATTTTTGATAAAGA
AGATGAAGACAAAGATGGGTTTATAT
CTGCCAGAGAATTTACATATAAACAC
GATGAGTTATAG

Expressed sequence (Tag sequence in lowercase):
mhhhhhhssgvdlgtenlyfq^smGA
LIPEPEVKIEVLQKPFICHRKTKGGD
LMLVHYEGYLEKDGSLFHSTHKHNNG
QPIWFTLGILEALKGWDQGLKGMCVG
EKRKLIIPPALGYGKEGKGKIPPEST
LIFNIDLLEIRNGPRS

^ TEV cleavage site

Tags and additions: N-terminal, TEV protease cleavable hexahistidine tag

Host: BL21(DE3)-R3-pRARE2

Growth Medium & Induction Protocol: A glycerol stock was used to inoculate 60 ml of TB media containing 50 µg/ml kanamycin and 34 µg/ml chloramphenicol, which was placed in a 37°C shaker overnight. The next day this starter culture was used to inoculate 12L of TB media (9 ml starter culture used per 1L) containing 50 µg/ml kanamycin. When the OD₆₀₀ reached approximately 1.0 the temperature was reduced to 18°C and after a further 30 minutes the cells were induced by the addition of 0.1 mM IPTG. The expression was continued overnight.

Cell Lysis: Cell pellets were dissolved in approximately 50ml lysis buffer and broken by passing through the homogeniser (x6) at a constant pressure of 15KPa. The cell debris was pelleted at 16,000 RPM and the supernatant used for further purification.
Lysis buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 10 mM Imidazole pH 7.4, 1 tablet per 50 ml protease inhibitor cocktail EDTA-free (Roche).

Column 1: Ni-NTA (5.0 ml volume in a gravity-flow column).

Column 1 Buffers:
Binding buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 20 mM Imidazole pH 7.4
Wash buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 40 mM Imidazole pH 7.4
Elution buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 250 mM Imidazole pH 7.4

Column 1 Procedure: The clarified cell extract was incubated with 5.0 ml pre-equilibriated 50% Ni-NTA bead solution for 1 hour at 4°C with rotation after which it was passed through a glass column. The column was then washed with 50ml Binding Buffer (2 x 25ml) and 50 ml Wash Buffer (2 x25 ml). The protein was eluted with 50 ml of Elution Buffer in 5 x 5 ml fractions.

Column 2: Superdex s75 16/60 Gel Filtration

Column 2 Buffers:
Gel Filtration buffer: 10 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol

Column 2 Procedure: Wash buffer fractions 1 and 2 were pooled along with a separate pool of elution fractions 1 and 2, from the Ni-NTA column. Each pool was then concentrate to 5ml and applied directly to the GF column (pre-equilibrated in GF Buffer) at 1.0 ml/min. 1.0 ml fractions were collected. The protein eluted at a volume of between 70 ml and 100 ml for the wash fractions pool and between 40ml and 100 ml for the elution fractions pool.

Enzymatic Treatment The N-terminal His6-tag was cleaved by incubating the protein overnight with TEV protease (20°C). Cleaved protein was purified by batch binding on 1ml pre-equilibriated 50% Ni-NTA bead solution. The column was then washed with 2 ml Gel Filtration Buffer (2x1ml) and 2 ml Binding Buffer (2x1 ml). The protein was eluted with 2 ml of Elution Buffer (2x1ml).

Gel Filtration buffer: 10 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol.
Binding buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 20 mM Imidazole pH 7.4
Elution buffer: 50 mM Hepes pH 7.4, 500 mM NaCl, 5% Glycerol, 250 mM Imidazole pH 7.4

Concentration: To set up plates the sample was concentrated to 25 mg/ml using a 10 kDa mwco concentrator

Mass spectrometry characterization:
Observed mass: 13815.06 Da
Expected mass: 13816.2 Da

Crystallization: Crystals were grown by vapour diffusion in sitting drop at 4°C. A sitting drop consisting of 75 nl protein and 75 nl well solution was equilibrated against well solution containing 18% PEG_3350; 0.1M HEPES pH 7.2. Crystals were mounted in the presence of 20% (v/v) glycerol and flash-cooled in liquid nitrogen

Data Collection:
Resolution: 1.82 Å X-ray source: Diamond IO3