Entry Clone Source: MGC

Entry Clone Accession: IMAGE:7262237

SGC Construct ID: CRYBB3A-c008

GenBank GI number: gi|4758074

Vector: pNIC28-Bsa4. Details [PDF ]; Sequence [ FASTA ] or [ GenBank ]

Amplified construct sequence:
CATATGCACCATCATCATCATCATTC
TTCTGGTGTAGATCTGGGTACCGAGA
ACCTGTACTTCCAATCCATGGGGGGC
AGCTACAAGGTGATCTTGTACGAACT
AGAGAACTTCCAAGGCAAACGCTGCG
AGCTCTCGGCCGAGTGCCCCAGCCTG
ACCGACAGCCTGCTGGAGAAGGTGGG
CTCCATCCAAGTGGAGTCCGGGCCGT
GGCTGGCATTTGAGTCCAGGGCCTTC
CGCGGGGAGCAGTTTGTTCTGGAGAA
GGGGGATTATCCTCGCTGGGATGCCT
GGTCCAACAGCCGTGATAGTGACAGC
CTTCTGTCCCTCCGGCCTCTGAATAT
TGATAGTCCACATCACAAGCTGCATC
TGTTTGAGAACCCAGCTTTCAGTGGC
CGCAAGATGGAGATAGTGGATGATGA
CGTGCCCAGCCTGTGGGCTCATGGCT
TCCAGGACCGTGTGGCGAGTGTCCGT
GCCATCAACGGGACGTGGGTTGGCTA
TGAGTTCCCCGGCTACCGTGGGCGCC
AGTACGTGTTTGAGCGGGGCGAGTAC
CGCCACTGGAATGAGTGGGACGCCAG
CCAGCCGCAGCTGCAGTCTGTGCGCC
GCATCCGTGACTGACAGTAAAGGTGG
ATACGGATCCGAA

Final protein sequence (Tag sequence in lowercase):
smGGSYKVILYELENFQGKRCELSAE
CPSLTDSLLEKVGSIQVESGPWLAFE
SRAFRGEQFVLEKGDYPRWDAWSNSR
DSDSLLSLRPLNIDSPHHKLHLFENP
AFSGRKMEIVDDDVPSLWAHGFQDRV
ASVRAINGTWVGYEFPGYRGRQYVFE
RGEYRHWNEWDASQPQLQSVRRIRD

The N-terminal residues, sm, derive from the vector following TEV protease digestion to remove the expression tag.

Tags and additions: N-terminal, TEV cleavable hexahistidine tag.

Host: BL21 (DE3)R3-pRARE2 (Phage resistant strain).

Growth medium, induction protocol: The construct DNA was transformed into competent cells of the expression strain by a standard heat shock procedure. A number of colonies were used to inoculate 1ml of LB media containing 50µg/ml kanamycin and 34µg/ml chloramphenicol, which was incubated in a 37°C shaker overnight. The next day glycerol stocks were prepared from this overnight culture. 5µl of a glycerol stock was used to inoculate 50ml of LB containing 50µg/ml kanamycin and 34µg/ml chloramphenicol, which was incubated at 37°C overnight. 15ml starter culture were used per litre TB, containing 50µg/ml kanamycin. The culture was incubated at 37°C until OD₆₀₀ reach ~1.2, when the temperature of the incubator was reduced to 18°C. Expression was induced with 0.1 mM IPTG and the culture continued overnight. Cells were pelleted at 6238g for 15min at 4°C, and stored at -80°C. The yield was 7.9g cells/litre culture.
Lysis buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 10 mM Imidazole; 5% Glycerol; 1 mM PMSF; 0.5 mM TCEP.
Extraction buffer, extraction method: The pellets were resuspended in lysis buffer. They were passed 4 times through an Emulsiflex C5 high-pressure homogeniser, collecting a final volume of approximately 35ml/L culture. cell debris and DNA were spun down at 45,000g for 60 minutes (Beckman JA18 17500rpm). The supernatant was collected to which Benzonase was added to the supernatant, with a 60 minute incubation on ice.

Column 1: Ni-sepharose column.

Column 1 Buffers:
Wash Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 30 mM Imidazole; 0.5 mM TCEP.
Elution Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 250 mM Imidazole; 0.5 mM TCEP.

Column 1 Procedure: The supernatant was loaded onto an equilibrated Ni-sepharose column (1ml resin/L culture). The flow through was collected. The column was first washed with 18CV of Lysis/Binding Buffer, followed by 10CV of Wash Buffer and finally eluted with 6x1CV elution buffer. Each fraction was collected and analyzed on SDS-PAGE.

Column 2: Gel filtration. GiLoad S200 16/60 - 120ml volume.

Column 2 Buffer: 50 mM HEPES, pH 7.5; 500 mM NaCl; 5% glycerol; 0.5 mM TCEP.

Column 2 Procedure: The gel filtration column was pre-equilibrated with Gel Filtration Buffer. The pooled Ni-sepharose eluants were loaded on the gel filtration column at a flow rate of 1.2ml/min. Eluted proteins were collected in 1.8ml fractions. The fractions containing protein were analyzed by SDS-PAGE.

Enzymatic treatment: Peak fractions from the gel filtration containing CRYBB3 were pooled and TEV protease was added at a molar ratio of 1:15. The digestion was left overnight at 4°C. SDS-PAGE and Mass Spec confirmed TEV digestion. His-TEV and contaminating proteins were removed by binding to Ni resin, pre-equilibrated in GF buffer.

Mass spectrometry characterization:
Measured: 20988.4Da
Expected: 20987.4Da

Protein concentration: The flow through containing TEV-cleaved protein, was collected and concentrated using an Amicon centrifugal filter with a 10kDa MW cut off. To remove any precipitation, the concentrated protein was centrifuged at 14000rpm for 20 min at 4°C and the supernatant was collected. The final concentration of protein was 46mg/ml and yield 15 mg/L culture. The protein was flash frozen and stored at -80°C in 70µl aliquots.

Crystallisation: Crystals grown at 4°C by vapour diffusion in sitting drops mixing protein (46mg/ml) and precipitant solution (0.1 M HEPES pH 7.5, 1.5 M Li₂SO₄) in a 2:1 ratio. Crystals were cryo-protected in 20% ethylene glycol before being flash-frozen in liquid nitrogen.

Data collection: Data was collected to a resolution of 1.8Å at Diamond Light source beamline I02.